Larchanka, Aleksandra I. ¹ and Orlova, Maria V. ²

¹✉ Scientific and Practical Center of the National Academy of Sciences of Belarus for Bioresources, Akademicheskaya str. 27, Minsk 220072, Belarus.
²Tyumen State Medical University, Odesskaya str. 54, Tyumen 625023, Russia.

2026 - Volume: 66 Issue: 3 pages: 770-789

Original research

Keywords

Abstract

Introduction

According to the most recent checklist of the mammalian fauna of Belarus, 18 bat species occur in the country (Shakun et al. 2026), all belonging to the family Vespertilionidae. Despite a long history of acarological research in the region, bat-associated mesostigmatid mites in Belarus remain insufficiently studied. Previously, no dedicated large-scale survey of mites associated with bats has been conducted in the country. Earlier information is limited to a brief faunistic note (Arzamasov and Kurskov 1962), records included in broader works dealing mainly with mites of rodents and other small mammals (Arzamasov 1968), and a later catalogue of the mite fauna of Belarus (Chikilevskaya et al. 1998).

Interpretation of the older records is complicated by taxonomic changes affecting both the mites and their bat hosts. Several names used in the historical literature, such as Spinturnix vespertilionis, Ichoronyssus flavus, and Steatonyssus musculi, were applied in a broad sense and cannot be confidently assigned to currently recognized species. In addition, some published host associations predate the separation of cryptic bat species, notably Pipistrellus pipistrellus (Schreber, 1774) and P. pygmaeus (Leach, 1825) (Barratt et al. 1997; Jones and von Parijs 1993), as well as Myotis mystacinus (Kuhl, 1817) and My. brandtii (Eversmann, 1845) (Gauckler and Kraus 1970; Hanák 1970). These taxonomic changes make careful reassessment of earlier host–parasite records essential.

Some historical records are also ecologically doubtful because they concern mite species primarily associated with rodents, birds, or their nests. In the summary table of the review of gamasid mites of Belarus, Arzamasov (1968) listed Nyctalus noctula (Schreber, 1774) as a host of the laelapids Haemolaelaps casalis (current name Androlaelaps casalis (Berlese, 1887)) and Hirstionyssus isabellinus (current name Echinonyssus isabellinus (Oudemans, 1913)), but did not provide any other evidence of their occurrence on bats. These species are typically associated with rodents, birds, and their nests. The same publication also reported Hirstionyssus musculi (Johnston, 1849) from Myotis daubentonii (Kuhl, 1817) and N. noctula. This species is usually associated with birds, insectivores, rodents, and their nests, but occasionally recorded from bats. These 3 species may be accidental or opportunistic associates of bats in Belarus.

A substantial advance in the study of bat-associated gamasid mites in Belarus was provided by the more recent systematic analysis of the fauna distributed in Russia and adjacent countries by Stanyukovich (1997), which included material from Belarus. That study reported nine taxa from Belarus for the first time: Spinturnix myoti (Kolenati, 1856), S. kolenatii Oudemans, 1910, S. acuminata (Koch, 1836), S. acuminata helvetiae (as S. helvetiae) Deunff, Keller & Aellen, 1986, S. mystacina (Kolenati, 1857), Steatonyssus occidentalis evansi (Ewing, 1933), St. noctulus Rybin, 1992, Macronyssus flavus (Kolenati, 1856), and M. evansi Stanyukovich, 1990. Later, Orlova et al. (2021b) documented seven mesostigmatid species and added four new country records: Spinturnix plecotina (Koch, 1839), Steatonyssus periblepharus Kolenati, 1858, Macronyssus corethroproctus (Oudemans, 1902), M. kolenatii (Oudemans, 1902). Thus, prior to the present study, 13 named taxa of bat-associated mesostigmatid mites had been reported from Belarus.

Here we present the results of a survey conducted in Belarus in 2019–2023, supplemented by selected archival material. Despite this new material, the composition, host associations, and distribution of bat-associated mites in Belarus remain incompletely understood.

Because sampling was not designed for quantitative parasitological analysis, this study is intended primarily as a faunistic, taxonomic, and distributional survey. The barcode data for Belarusian representatives of Spinturnix punctata (Sundevall, 1833), S. myoti, Macronyssus flavus and M. corethroproctus obtained in this study are intended to add COI sequences to the still limited set of reliable reference sequences in GenBank. The aims of the study were to document the species composition of bat-associated mesostigmatid mites in Belarus based on newly collected material, to summarize host associations and distributional data, and to compile an updated checklist of previously published records as a foundation for future integrative taxonomic work.

Materials and methods

Sampling

The sampling design was not standardized for quantitative parasitological analysis but was intended to collect qualitative faunistic data. Material was collected in Belarus during the summer seasons of 2019–2023. Field sampling covered 79 localities in 34 districts across all six administrative regions of the country. Additional material was examined from the archival collections of V. V. Dziamianchyk (collected in 1998–2021) and the Department of Entomology, Moscow State University (collected by S. V. Kruskop in 1996).

Bats were captured using mist nets. As bats are a protected mammalian group, all examinations were performed non-lethally, with efforts to minimize handling time, stress, and the risk of injury. All captured bats were identified morphologically following Dietz and Kiefer (2016).

Each captured bat was placed individually in a clean cotton bag. Ectoparasites were then removed with forceps from the wing membranes, uropatagium, tragus, auricles, and muzzle. The fur was additionally blown through and inspected, and any visible ectoparasites were collected with forceps. Because the principal aim of the study was to document the species composition, host associations, and distribution of bat-associated mites in Belarus, exhaustive collection of all ectoparasites from each host individual was not attempted. This substantially reduced handling time and stress for the bats but did not allow quantitative parasitological analysis. Accordingly, the present paper addresses only the fauna of Mesostigmata associated with bats in Belarus.

All mites collected from a single bat individual were placed together in one vial containing 70% ethanol. In the laboratory, samples were cleaned of debris and permanent slides were prepared. Macronyssid mites were mounted in Fora–Berlese medium following the standard protocol (Bregetova 1956). Prior to mounting, spinturnicid mites were cleared for approximately 12 h in 10% KOH and then transferred to Fora–Berlese medium.

Morphological identification was carried out using specialized keys and taxonomic treatments for bat-associated mites (Orlova and Anisimov 2023; Orlova, Stanyukovich and Orlov 2015; Radovsky 2010; Rudnick 1960; Stanyukovich 1997). Permanent slide preparations were deposited in the collection of the Zoological Institute, Russian Academy of Sciences (ZIN RAS), St. Petersburg, Russia.

DNA extraction and amplification

Total DNA was extracted using a simplified CTAB protocol (Voropaev, Padutov and Baranov 2007). For mites of the family Spinturnicidae, DNA was extracted from individual specimens; for Macronyssidae – from pooled specimens collected from the same host. In addition, one comparative specimen of M. flavus from the Republic of Mordovia, Russia, was sequenced to confirm species identification.

Sequencing was performed using the Sanger method. A fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI, mtCOI) was selected as the marker region. The following primers were used (5′ – 3′): HCO2198 (R) TAAACTTCAGGGTGACCAAAAATCA; LCO1490 (F) GGTCAACAAATCATAAAGATATTGG.

Polymerase chain reaction (PCR) was performed using ArtMix ForEZ (2×) kits (ArtBioTech, Republic of Belarus) according to the manufacturer's instructions. The thermal cycling profile was as follows: initial denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 20 s, and extension at 72 °C for 45 s; followed by cooling at 4 °C for 5 min. PCR products were separated by electrophoresis in horizontal chambers in 1.5% agarose gel using 1× TBE buffer according to the instructions for the electrophoretic equipment used.

Sequencing reactions were performed in 200 µl polypropylene thin-walled tubes using the BigDye Terminator v1.1 Cycle Sequencing Kit, following the manufacturer's recommendations, with the following program: initial denaturation at 96 °C for 1 min; 40 cycles of denaturation at 96 °C for 10 s, annealing at 50 °C for 5 s, and extension at 60 °C for 3 min; followed by cooling at 4 °C for 5 min. Electrophoretic analysis of sequencing products was carried out on an Applied Biosystems® 3500 Genetic Analyzer (Thermo Scientific, USA) according to the manufacturer's protocol.

Species identity of the obtained sequences was preliminarily assessed using NCBI BLAST searches against the GenBank database. Because publicly available reference sequences for bat-associated mesostigmatid mites remain scarce, barcode data were used primarily as an additional molecular reference framework complementing morphology-based identifications. The newly obtained partial COI sequences were deposited in GenBank under accession numbers PP266267–PP266273. The occurrence dataset supporting this study has been published in GBIF (Larchanka 2026). The molecular data presented here are intended primarily as supplementary reference barcodes and were not used as the main basis for species identification or for broader genetic inference.

Results

Based on the material examined in the present study together with previously published records regarded here as credible, the bat-associated mesostigmatid fauna of Belarus currently comprises 16 named taxa belonging to 2 families and 3 genera (Table 1). Of these, 12 species were recorded in the material examined here. Macronyssus kolenatii is known from previously published Belarusian material documented by voucher specimens (Orlova et al. 2021b). In addition, S. acuminata helvetiae, M. evansi, and St. occidentalis evansi were reported by Stanyukovich (1997) from older Belarusian material; although these taxa were not found in the present study and the original specimens are no longer available for re-examination, we provisionally retain them in the checklist as likely components of the bat-associated mesostigmatid fauna of Belarus. Several further historical records published under broad or doubtful names cannot be assigned confidently to currently recognized taxa and are therefore treated separately in Table 1. The record of St. superans Zemskaja, 1951 is likewise excluded from the main checklist because it appears to be based on a secondary citation error: Chikilevskaya et al. (1998) referred to Arzamasov and Kurskov (1962), but that source listed only St. musculi and provided no record of St. superans.

A total of 1110 bats representing 14 species were captured during the period of mite sampling: Barbastella barbastellus (Schreber, 1774) (n=35), Eptesicus nilssonii (Keyserling & Blasius, 1839) (n=29), E. serotinus (Schreber, 1774) (n=17), Myotis brandtii (n=5), My. dasycneme (Boie, 1825) (n=43), My. daubentonii (n=223), My. nattereri (Kuhl, 1817) (n=14), Nyctalus lasiopterus (Schreber, 1780) (n=3), N. leisleri (Kuhl, 1817) (n=19), N. noctula (n=207), Pipistrellus nathusii (Keyserling & Blasius, 1839) (n=265), P. pygmaeus (n=148), Plecotus auritus (Linnaeus, 1758) (n=28), Vespertilio murinus Linnaeus, 1758 (n=74). From these bats, 717 mesostigmatid mites were collected from 210 bat individuals. Because the primary aim of this study was species identification and documentation of host associations, mites were not collected exhaustively from every captured bat and usually only a limited number of specimens were removed from each infested individual. The infestation parameters observed here should therefore be regarded as minimum estimates, and the true prevalence and intensity of infestation are likely substantially higher than indicated by the present material. In addition, 16 archival samples comprising 67 mesostigmatid mites from the collections of V. V. Dziamianchyk and S. V. Kruskop were examined and identified. In the material examined here, including field collections from 2019–2023 and the selected archival samples, bat-associated mesostigmatid mites were recorded from 12 bat species. The full occurrence dataset underlying this study has been published in open access through GBIF (Larchanka 2026). Figure 1 combines these host-association data with comparable records from Orlova et al. (2021b).

Altogether, 12 mite species belonging to 2 families and 3 genera were found. Spinturnix punctata, Steatonyssus spinosus Willmann, 1936 and Macronyssus diversipilis (Vitzthum, 1920) were recorded from Belarus for the first time.

Bat species were unevenly represented in the material. Some species, such as N. leisleri, My. nattereri, and B. barbastellus, are relatively rare in Belarus and were infrequently represented in the material. Accordingly, only limited information on their mite fauna could be obtained. In other species, including V. murinus, E. nilssonii, and Pl. auritus, mites were recorded only occasionally and usually in low numbers, although these bats were captured regularly. By contrast, mites were recorded repeatedly and across multiple localities in the common and widely distributed P. nathusii, P. pygmaeus, N. noctula, and My. daubentonii.

Superorder Parasitiformes

Infraorder Gamasina

Family Spinturnicidae

Genus Spinturnix Heyden, 1826

Spinturnix acuminata (Koch, 1836)

Recorded from Brest, Gomel, Grodno, Minsk, Mogilev, and Vitebsk regions in 1996–2023, predominantly from Nyctalus noctula; additional records were obtained from N. leisleri, Pipistrellus nathusii, and Plecotus auritus.

Material — ex N. noctula, from Brest Reg., Brest distr., (52.098115, 23.760005), 18 Aug. 2006, leg. A.I. Larchanka, V. V. Dziamianchyk; ex bat, from Brest Reg., Brest distr., 20 Apr. 1998, leg. A.I. Larchanka, V. V. Dziamianchyk; ex N. noctula, from Brest Reg., 26 Aug. 2006, leg. A.I. Larchanka, V. V. Dziamianchyk; ex N. leisleri, from Gomel Reg., Chachersk distr., (53.087308, 31.213771), 7 Jun. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Chachersk distr., (53.087308, 31.213771), 7 Jun. 2023, leg. A.I. Larchanka; ex N. leisleri, from Gomel Reg., Lyelchytsy distr., (51.59994, 28.54562), 19 Jul. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Lyelchytsy distr., (51.59994, 28.54562), 19 Jul. 2021, leg. A.I. Larchanka; ex N. leisleri, from Gomel Reg., Lyelchytsy distr., (51.61896, 28.47302), 22 Jul. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Lyelchytsy distr., (51.60375, 28.51722), 20 Jul. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Lyelchytsy distr., (51.92495, 28.12423), 15 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Zhytkavichy distr., (52.03505, 28.15506), 14 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Narowlya distr., (51.532544, 29.812548), 26 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.91452, 24.11705), 31 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.84145, 24.03572), 1 Sept. 2021, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.84064, 24.25756), 2 Sept. 2021, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Myadzyel distr., (54.89271, 26.68038), 18 Jul. 2019, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Barysaw distr., (54.65279, 28.23862), 10 Aug. 2020, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Stowbtsy distr., (53.789523, 26.331697), 25 Jul. 2022, leg. A.I. Larchanka; ex N. noctula, from Mogilev Reg., Krasnapollye distr., (53.438164, 31.370819), 12 Jul. 2023, leg. A.I. Larchanka; ex Pl. auritus, from Mogilev Reg., Kruhlaye distr., (54.149583, 29.44224), 10 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Haradok distr., (55.718735, 29.752421), 2 Aug. 2023, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Haradok distr., (55.718735, 29.752421), 2 Aug. 2023, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Dokshytsy distr., (54.96886, 28.01808), 11 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Lyepyel distr., (54.74879, 28.31484), 9 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Lyepyel distr., 15 Jul. 1996, leg. S. V. Kruskop.

Distribution — Europe: Belarus (Orlova et al. 2021b; as Belorussia, Stanyukovich 1997), Czechia, Estonia, Germany, Latvia, Slovakia, Ukraine (Stanyukovich 1997), United Kingdom (Stanyukovich 1997; Baker and Craven 2003), Austria, Belgium, Bulgaria, Denmark, Italy, Moldova (as Moldavia), Netherlands (as Holland), Norway, Poland, Romania, Spain (Beron 2020). Transcontinental: Russia (Stanyukovich 1997; Beron 2020), Turkey (Beron 2020). Asia: Afghanistan, China, India, Israel, Japan, Malaysia, Sri Lanka (Beron 2020), Azerbaijan, Kazakhstan, Kyrgyzstan, Tajikistan (Stanyukovich 1997). Africa: Morocco (Beron 2020).

Hosts — Nyctalus lasiopterus, Barbastella leucomelas (Cretzschmar, 1826), Myotis myotis (Borkhausen, 1797), Pipistrellus kuhlii (Kuhl, 1817) (Beron 2020), N. leisleri, N. noctula, Rhinolophus sp., Eptesicus serotinus, Hypsugo savii (Bonaparte, 1837) (as Pipistrellus savii), Murina leucogaster Milne-Edwards, 1872, Myotis blythii (Tomes, 1857), My. dasycneme, My. daubentonii, Pipistrellus pipistrellus, P. nathusii, Scotophilus heathii (Horsfield, 1831) (as Scotophilus temminicki wrougthtoni) (Stanyukovich 1997), Plecotus auritus (this study).

Pathogen detection — Bartonella sp. (Sándor et al. 2024).

Spinturnix punctata (Sundevall, 1833) (= Spinturnix barbastelli (Kolenati, 1856))

Recorded from Gomel, Grodno, and Minsk regions in 2020–2023, predominantly from Barbastella barbastellus; additional records were obtained from Myotis nattereri and Nyctalus noctula.

Material — ex B. barbastellus, from Gomel Reg., Lyelchytsy distr., (51.71035, 28.53108), 23 Jul. 2021, leg. A.I. Larchanka; ex B. barbastellus, from Gomel Reg., Zhytkavichy distr., (52.03505, 28.15506), 14 Aug. 2021, leg. A.I. Larchanka; ex B. barbastellus, from Grodno Reg., Svislach distr., (52.91452593, 24.11705443), 2 Sept. 2020, leg. A.I. Larchanka; ex My. nattereri, from Grodno Reg., Svislach distr., (52.91152031, 24.17355979), 3 Sept. 2020, leg. A.I. Larchanka; ex B. barbastellus, from Grodno Reg., Svislach distr., (52.91452, 24.11705), 31 Aug. 2021, leg. A.I. Larchanka; ex B. barbastellus, from Grodno Reg., Svislach distr., (52.84145, 24.03572), 1 Sept. 2021, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Salihorsk distr., (52.725228, 27.504619), 16 Aug. 2023, leg. A.I. Larchanka; ex B. barbastellus, from Minsk Reg., Stowbtsy distr., (53.913209, 26.698769), 28 Jul. 2022, leg. A.I. Larchanka.

Distribution — Europe: Belarus (this study), Lithuania, Moldova, United Kingdom, Netherlands, Poland, Czechia, Slovakia (Stanyukovich 1997), Bulgaria, France (Corsica), Germany, Spain, Sweden, Switzerland (Beron 2020). Transcontinental: Russia (the Far East) (Stanyukovich 1997; Beron 2020), Turkey (Beron 2020). Asia: Kyrgyzstan (Stanyukovich 1997; Rybin 1983), Tajikistan (Orlova and Kazakov 2016). Caucasus: Armenia (Stanyukovich 1997), Georgia (Orlova et al. 2021c).

Hosts — Barbastella barbastellus (Stanyukovich 1997), B. leucomelas darjelingensis (Hodgson, 1855), Hypsugo savii (Beron 2020), Myotis nattereri, Nyctalus noctula (this study).

Pathogen detection — Not reported.

Remark — A partial COI barcode sequence was deposited in GenBank under accession no. PP266269.1. No close conspecific match was available in GenBank. The nearest available Spinturnix sequences showed approximately 84-85% identity (Spinturnix andegavinus Kolenati, 1857, PZ669677.1, 85.02% identity; S. andegavinus, MK140050.1, 84.34% identity). GenBank already contains sequences attributed to S. punctata, but direct comparison was not possible because they represent a different, non-overlapping region of the COI gene. The molecular data therefore provide an additional barcode record for the species.

Spinturnix kolenatii Oudemans, 1910

Records from Gomel and Vitebsk regions in 2020–2023, obtained from Eptesicus nilssonii, E. serotinus, and Nyctalus noctula.

Material — ex N. noctula, from Gomel Reg., Lyelchytsy distr., (51.61896, 28.47302), 22 Jul. 2021, leg. A.I. Larchanka; ex E. serotinus, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex E. nilssonii, from Vitebsk Reg., Haradok distr., (55.772468, 29.8333098), 1 Aug. 2023, leg. A.I. Larchanka; ex E. nilssonii, from Vitebsk Reg., Lyepyel distr., (54.70088, 28.30230), 12 Aug. 2020, leg. A.I. Larchanka.

Distribution — Europe: Belarus (as Belorussia), Czechia, Estonia, Germany, Latvia, Lithuania, Moldova, Netherlands, Slovakia, Ukraine (Stanyukovich 1997), United Kingdom (Stanyukovich 1997; Baker and Craven 2003), Finland, Hungary, Norway, Poland, Spain (Beron 2020). Transcontinental: Russia (Stanyukovich 1997; Beron 2020). Caucasus: Armenia, Georgia (Stanyukovich 1997). Asia: Azerbaijan, Kazakhstan, Kyrgyzstan, Turkmenistan, Uzbekistan (Stanyukovich 1997), Afghanistan, Japan, Mongolia (Beron 2020). North America: USA (Stanyukovich 1997). Africa: Namibia (Orlova et al. 2020a).

Hosts — Eptesicus nilssonii (as E. parvus) (Stanyukovich 1997; Uchikawa and Wada 1979), E. serotinus (as E. turcomanus) (Beron 2020; Stanyukovich 1997), E. gobiensis Bobrinskii, 1926 (Scheffler et al. 2016), E. hottentotus (Smith, 1833) (Orlova et al. 2020a), Plecotus auritus, Myotis blythii, My. daubentonii, My. brandtii, My. mystacinus, Nyctalus noctula, Pipistrellus nathusii, Vespertilio murinus, Murina hilgendorfi (Peters, 1880) (as Mu. leucogaster) (Stanyukovich 1997), Myotis sibiricus Kastschenko, 1905 (as My. brandtii) (Medvedev et al. 1991), Pipistrellus pipistrellus (Beron 2020).

Pathogen detection — Not reported.

Spinturnix myoti (Kolenati, 1856)

Records from Brest, Gomel, Grodno, Minsk, Mogilev, and Vitebsk regions in 1996–2023, obtained mainly from Myotis daubentonii and My. dasycneme; additional records were made from My. nattereri, Pipistrellus nathusii, P. pygmaeus and Plecotus auritus.

Material — ex My. daubentonii, from Brest Reg., Kamyenyets distr., (52.62881, 23.85598), 3 Sept. 2021, leg. A.I. Larchanka; ex My. daubentonii, from Gomel Reg., Zhytkavichy distr., (52.03505, 28.15506), 14 Aug. 2021, leg. A.I. Larchanka; ex My. daubentonii, from Gomel Reg., Narowlya distr., (51.532544, 29.812548), 26 Jul. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Gomel Reg., Narowlya distr., (51.532544, 29.812548), 26 Jul. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Gomel Reg., Rechytsa distr., (52.441687, 30.379265), 26 Jun. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Grodno Reg., Iwye distr., (53.96810, 26.32883), 26 Aug. 2019, leg. A.I. Larchanka; ex My. daubentonii, from Grodno Reg., Grodno distr., (53.91183, 23.62848), 6 Jul. 2021, leg. A.I. Larchanka; ex My. nattereri, from Grodno Reg., Svislach distr., (52.91152031, 24.17355979), 3 Sept. 2020, leg. A.I. Larchanka; ex My. daubentonii, from Grodno Reg., Svislach distr., (52.91452, 24.11705), 31 Aug. 2021, leg. A.I. Larchanka; ex My. nattereri, from Grodno Reg., Svislach distr., (52.84064, 24.25756), 2 Sept. 2021, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Myadzyel distr., (54.82081, 26.56465), 17 Jul. 2019, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Myadzyel distr., (54.89271, 26.68038), 18 Jul. 2019, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Myadzyel distr., (54.82933, 26.87240), 25 Jul. 2019, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Dzyarzhynsk distr., (53.73813301, 26.98632781), 10 Jul. 2020, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Myadzyel distr., (54.82687109, 26.87053130), 25 Aug. 2020, leg. A.I. Larchanka; ex My. dasycneme, from Minsk Reg., Myadzyel distr., (54.77111596, 26.85791708), 4 Jul. 2022, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Myadzyel distr., (54.77111596, 26.85791708), 4 Jul. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Myadzyel distr., (54.77111596, 26.85791708), 4 Jul. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Myadzyel distr., (54.89271, 26.68038), 5 Jul. 2022, leg. A.I. Larchanka; ex My. dasycneme, from Minsk Reg., Myadzyel distr., (54.82933, 26.87240), 6 Jul. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Salihorsk distr., (52.725228, 27.504619), 16 Aug. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Stowbtsy distr., (53.852479, 26.427339), 26 Jul. 2022, leg. A.I. Larchanka; ex Pl. auritus, from Minsk Reg., Stowbtsy distr., (53.852479, 26.427339), 26 Jul. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Minsk Reg., Stowbtsy distr., (53.913209, 26.698769), 28 Jul. 2022, leg. A.I. Larchanka; ex P. pygmaeus, from Mogilev Reg., Bykhaw distr., (55.34589, 29.21235), 4 Jul. 2019, leg. A.I. Larchanka; ex My. daubentonii, from Mogilev Reg., Byalynichy distr., (54.074468, 29.499215), 11 Jul. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Mogilev Reg., Kruhlaye distr., (54.149583, 29.44224), 10 Jul. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Mogilev Reg., Slawharad distr., (53.407402, 31.019938), 11 Jul. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Mogilev Reg., Slawharad distr., (53.407402, 31.019938), 12 Jul. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Haradok distr., (55.714076, 29.878988), 24 Aug. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Haradok distr., (55.568927, 29.865012), 25 Aug. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Haradok distr., (55.657437, 29.584828), 27 Aug. 2022, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Haradok distr., (55.568927, 29.865012), 31 Jul. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Haradok distr., (55.772468, 29.8333098), 1 Aug. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Haradok distr., (55.718735, 29.752421), 2 Aug. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Haradok distr., (55.678026, 29.598124), 3 Aug. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Lyepyel distr., (54.70088, 28.30230), 12 Aug. 2020, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Lyepyel distr., (54.78081, 28.49468), 12 Aug. 2021, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Lyepyel distr., (54.78081, 28.49468), 12 Aug. 2021, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Lyepyel distr., 15 Jul. 1996, leg. S. V. Kruskop; ex My. daubentonii, from Vitebsk Reg., Polotsk distr., (55.30698, 28.39317), 10 Jun. 2021, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Polotsk distr., (55.69081, 29.25274), 13 Jun. 2021, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Rasony distr., (55.98842, 28.60384), 11 Jun. 2021, leg. A.I. Larchanka; ex My. daubentonii, from Vitebsk Reg., Rasony distr., (56.02141, 28.40659), 5 Aug. 2021, leg. A.I. Larchanka.

Distribution — Europe: Belarus (Orlova et al. 2021b; as Belorussia, Stanyukovich 1997), Belgium, Bulgaria, Czechia, Estonia, France, Germany, Hungary, Italy, Latvia, Lithuania, Moldova, Netherlands, Romania, Slovakia, Ukraine, former Yugoslavia (Stanyukovich 1997), United Kingdom (Stanyukovich 1997; Baker and Craven 2003), Austria, Bosnia and Herzegovina, Finland, North Macedonia (as Macedonia), Montenegro, Norway, Poland, Portugal, Serbia, Spain (Beron 2020). Transcontinental: Russia (Stanyukovich 1997; Beron 2020), Turkey (Beron 2020). Caucasus: Armenia, Azerbaijan (as Azerbaidjan), Georgia (Stanyukovich 1997). Asia: Afghanistan, Japan, Kazakhstan (as Kazachstan), Kyrgyzstan (as Kirgizstan), Mongolia, Tajikistan, Turkmenistan, Uzbekistan (Stanyukovich 1997); India (Jammu and Kashmir), Israel (Beron 2020). Africa: Morocco (Stanyukovich 1997), Algeria (Beron 2020).

Hosts — Myotis myotis, My. nattereri, My. mystacinus, My. emarginatus (Geoffroy, 1806), Nyctalus noctula, Barbastella barbastellus, Pipistrellus nathusii, P. pipistrellus, Plecotus auritus, Miniopterus schreibersii (Kuhl, 1817), Rhinolophus euryale Blasius, 1853, R. hipposideros (Bechstein, 1800), R. ferrumequinum (Schreber, 1774), R. mehelyi Matschie, 1901, Vespertilio murinus, V. sinensis (Peters, 1880) (as V. superans), Otonycteris leucophaea Severtzov, 1873 (as Otonycteris hemprichii) (Stanyukovich 1997), Myotis blythii (Orlova et al. 2015; Stanyukovich 1997), My. punicus Felten, Spitzenberger & Storch, 1977, Tadarida teniotis (Rafinesque, 1814) (Benda et al. 2014), Myotis brandtii (Stanyukovich 1990; Orlova 2011; Stanyukovich 1997), My. capaccinii (Bonaparte, 1837) (Benda et al. 2012), My. dasycneme (Orlova 2011; Orlova et al. 2014; Stanyukovich 1997), My. daubentonii (Orlova 2011; Stanyukovich 1997), My. petax Hollister, 1912 (Orlova et al. 2015; Orlova, Orlov and Zhigalin 2014), My. ikonnikovi Ognev, 1912 (Orlova et al. 2015), My. macrodactylus (Temminck, 1840) (as My. capaccinii) (Medvedev et al. 1991), My. sibiricus (Orlova et al. 2017), Murina hilgendorfi (Orlova et al. 2015), Pipistrellus pygmaeus (this study).

Pathogen detection — Bartonella spp. (Sándor et al. 2024; Zheng et al. 2025), Rickettsia spp. (Szubert-Kruszyńska et al. 2019), Chlamydiae, Chlamydiaceae (Thiévent et al. 2020), Pseudogymnoascus destructans (white-nose syndrome fungus) (Lučan et al. 2016).

Remark — The two specimens morphologically identified as S. myoti yielded partial COI sequences, PP266267 and PP266268. BLAST comparison did not provide an unambiguous species-level assignment, because both sequences showed up to 100% identity with several sequences deposited in GenBank as S. andegavinus (MK140040, MK140042, MK140035, MK140034). The Belarusian specimens are retained as S. myoti based on morphology.

Spinturnix mystacina (Kolenati, 1857)

Records from Gomel, Grodno, and Mogilev regions in 2021–2023, obtained from Myotis brandtii, My. nattereri, and Barbastella barbastellus.

Material — ex B. barbastellus, from Gomel Reg., Zhytkavichy distr., (52.03505, 28.15506), 14 Aug. 2021, leg. A.I. Larchanka; ex My. nattereri, from Grodno Reg., Svislach distr., (52.84064, 24.25756), 2 Sept. 2021, leg. A.I. Larchanka; ex My. brandtii, from Mogilev Reg., Krasnapollye distr., (53.438164, 31.370819), 13 Jul. 2023, leg. A.I. Larchanka.

Distribution — Europe: Belarus (as Belorussia), Czechia, France, Germany, Moldova (as Moldavia), Netherlands (as Holland), Slovakia (Stanyukovich 1997; Beron 2020), United Kingdom (Stanyukovich 1997; Baker and Craven 2003), Bulgaria, Finland, Italy, Norway, Poland, Romania, Spain (Beron 2020). Transcontinental: Russia (Stanyukovich 1997; Beron 2020). Asia: Kazakhstan, Tajikistan (Stanyukovich 1997; Beron 2020), Kyrgyzstan, Japan, Mongolia (Beron 2020). Africa: Morocco (Beron 2020).

Hosts — Myotis mystacinus, My. brandtii (Stanyukovich 1990; Stanyukovich 1997), My. sibiricus, My. davidii (Peters, 1869) (as My. aurascens), My. ikonnikovi, My. nattereri, My. alcathoe von Helversen & Heller, 2001, Eptesicus gobiensis, Hypsugo alaschanicus (Bobrinskii, 1926) (Beron 2020), Myotis myotis, My. petax, My. dasycneme, Eptesicus serotinus, Nyctalus noctula, Plecotus auritus, Vespertilio murinus (Stanyukovich 1997), Barbastella barbastellus (this study).

Pathogen detection — Bartonella sp. (Sándor et al. 2024).

Spinturnix plecotina (Koch, 1839)

Records from Gomel, Grodno, Mogilev, and Vitebsk regions in 2020–2023, all obtained from Plecotus auritus.

Material — ex Pl. auritus, from Gomel Reg., Chachersk distr., (53.087308, 31.213771), 7 Jun. 2023, leg. A.I. Larchanka; ex Pl. auritus, from Gomel Reg., Lyelchytsy distr., (51.92495, 28.12423), 15 Aug. 2021, leg. A.I. Larchanka; ex Pl. auritus, from Grodno Reg., Svislach distr., (52.91152031, 24.17355979), 3 Sept. 2020, leg. A.I. Larchanka; ex Pl. auritus, from Mogilev Reg., Kruhlaye distr., (54.149583, 29.44224), 10 Jul. 2023, leg. A.I. Larchanka; ex Pl. auritus, from Vitebsk Reg., Haradok distr., (55.568927, 29.865012), 31 Jul. 2023, leg. A.I. Larchanka; ex Pl. auritus, from Vitebsk Reg., Lyepyel distr., (54.74879, 28.31484), 9 Aug. 2021, leg. A.I. Larchanka.

Distribution — Europe: Belarus (Orlova et al. 2021b), Bulgaria, Czechia, Estonia, France, Germany, Latvia, Lithuania, Moldova, Netherlands, Slovakia, Ukraine, former Yugoslavia (Stanyukovich 1997), United Kingdom, Ireland (Stanyukovich 1997; Baker and Craven 2003), Finland, Norway, Poland, Romania, Spain (Beron 2020). Transcontinental: Russia (Stanyukovich 1997; Beron 2020), Turkey (Beron 2020). Caucasus: Armenia (Stanyukovich 1997). Asia: Afghanistan (Stanyukovich 1997; Beron 2020), Tajikistan, Uzbekistan (Stanyukovich 1997); China, Japan, Mongolia, Taiwan (Beron 2020). Africa: Morocco (Beron 2020). Atlantic islands: Canary Islands (Beron 2020).

Hosts — Myotis brandtii, Plecotus auritus (Stanyukovich 1990), Pl. ognevi Kishida, 1927 (as Pl. auritus), My. sibiricus (as My. brandtii) (Medvedev et al. 1991), Pl. sacrimontis Allen, 1908, Pl. kozlovi Bobrinskii, 1926, Pl. teneriffae Barrett-Hamilton, 1907, Barbastella barbastellus, Eptesicus serotinus, Rhinolophus euryale, R. lepidus Blyth, 1844 (Beron 2020), Pl. austriacus (Fischer, 1829), B. leucomelas, E. nilssonii, My. daubentonii, My. nattereri, R. ferrumequinum (Stanyukovich 1997), My. dasycneme (Orlova et al. 2014), Nyctalus noctula (Rudnick 1960).

Pathogen detection — Not reported.

Family Macronyssidae

Subfamily Macronyssinae

Genus Macronyssus Kolenati, 1858

Macronyssus corethroproctus (Oudemans, 1902)

Records from Gomel, Grodno, Minsk, and Vitebsk regions in 2020–2023, obtained mainly from Myotis dasycneme; additional records were made from Pipistrellus nathusii, Nyctalus noctula, and N. leisleri.

Material — ex N. leisleri, from Gomel Reg., Chachersk distr., (52.962972, 31.201861), 8 Jun. 2023, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.84145, 24.03572), 1 Sept. 2021, leg. A.I. Larchanka; ex My. dasycneme, from Minsk Reg., Myadzyel distr., (54.77111596, 26.85791708), 4 Jul. 2022, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Myadzyel distr., (54.77111596, 26.85791708), 4 Jul. 2022, leg. A.I. Larchanka; ex My. dasycneme, from Minsk Reg., Myadzyel distr., (54.82933, 26.87240), 6 Jul. 2022, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Haradok distr., (55.718735, 29.752421), 2 Aug. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Haradok distr., (55.678026, 29.598124), 3 Aug. 2023, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Lyepyel distr., (54.70088, 28.30230), 12 Aug. 2020, leg. A.I. Larchanka.

Distribution — Europe (Dusbábek and Radovsky 1972; Haitlinger 1978; Orlova and Zapart 2012; Radovsky 1967, Orlova, Stanyukovich and Orlov 2015): Belarus (Orlova et al. 2021b), Latvia, Moldova, Hungary, Netherlands, Poland (Stanyukovich 1997). Transcontinental: Russia (Stanyukovich 1997; Orlova et al. 2020b), Urals (Orlova 2011; Orlova et al. 2015, 2020b), Western Siberia, Altai (Orlova et al. 2015, 2020b). Asia: Kazakhstan (Stanyukovich 1997).

Hosts — Myotis dasycneme, My. mystacinus, My. blythii, Pipistrellus nathusii, Vespertilio murinus (Stanyukovich 1997), My. nattereri, My. brandtii, Eptesicus nilssonii (Orlova et al. 2021a), My. daubentonii (Orlova et al. 2011), Nyctalus noctula, N. leisleri (this study).

Pathogen detection — Not reported.

Remark — Two partial COI barcode sequences have been deposited in GenBank under accession nos. PP266272 (closest matches in the database show 82.53% identity to Haemogamasus ambulans (Thorell, 1872), MG414996.1) and PP266273 (Ologamasidae sp., MN347639.1, 85.94% identity). The sequences differed by 1.41% over the overlapping region. At the time of analysis, these were the only available barcodes of M. corethroproctus in GenBank.

Macronyssus diversipilis (Vitzthum, 1920)

Records from Vitebsk Region in 2020, obtained from Myotis daubentonii and My. dasycneme.

Material — ex My. daubentonii, from Vitebsk Reg., Lyepyel distr., (54.70088, 28.30230), 12 Aug. 2020, leg. A.I. Larchanka; ex My. dasycneme, from Vitebsk Reg., Lyepyel distr., (54.70088, 28.30230), 12 Aug. 2020, leg. A.I. Larchanka.

Distribution — Europe (Haitlinger 1978; Radovsky 1967): Belarus (this study), Estonia, Germany, Hungary, Moldova, Netherlands (Stanyukovich 1997), United Kingdom (Baker and Craven 2003). Transcontinental: Russia (Stanyukovich 1997), Urals (Orlova 2011). Caucasus: Republic of Dagestan (Orlova et al. 2020b).

Hosts — Myotis daubentonii (Stanyukovich 1990; Orlova 2011; Radovsky 1967), My. nattereri, Plecotus auritus, Vespertilio murinus (Radovsky 1967), My. myotis (Dusbábek and Radovsky 1972), My. blythii, My. bechsteinii (Kuhl, 1817), My. dasycneme, Rhinolophus hipposideros (Haitlinger and Walter 1997), My. brandtii (Stanyukovich 1990; Haitlinger and Walter 1997), My. tschuliensis Kuzyakin, 1935 (Orlova et al. 2020b), Barbastella barbastellus (Beron 2014; Haitlinger 1978), Pipistrellus pipistrellus (Beron 2014; Radovsky 1967), Eptesicus nilssonii, E. serotinus (Stanyukovich 1997), R. euryale, Miniopterus schreibersii, P. nathusii, Nyctalus noctula (Beron 2014).

Pathogen detection — Not reported.

Macronyssus flavus (Kolenati, 1856)

Records from Brest, Gomel, Grodno, Minsk, Mogilev, and Vitebsk regions in 1996–2023, obtained mainly from Nyctalus noctula; additional records were made from N. leisleri, Pipistrellus nathusii, P. pygmaeus, and Myotis daubentonii.

Material — ex N. noctula, from Brest Reg., Brest distr., (51.555143, 23.602705), 15 Jul. 1998, leg. A.I. Larchanka, V. V. Dziamianchyk; ex bat, from Brest Reg., Brest distr., 20 Apr. 1998, leg. A.I. Larchanka, V. V. Dziamianchyk; ex P. nathusii, from Brest Reg., Stolin distr., (52.141970, 26.811713), 27 May 2008, leg. A.I. Larchanka, V. V. Dziamianchyk; ex N. noctula, from Brest Reg., 26 Aug. 2006, leg. A.I. Larchanka, V. V. Dziamianchyk; ex N. leisleri, from Gomel Reg., Chachersk distr., (53.087308, 31.213771), 7 Jun. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Chachersk distr., (53.087308, 31.213771), 7 Jun. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Chachersk distr., (52.962972, 31.201861), 8 Jun. 2023, leg. A.I. Larchanka; ex N. leisleri, from Gomel Reg., Chachersk distr., (52.962972, 31.201861), 8 Jun. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Lyelchytsy distr., (51.59994, 28.54562), 19 Jul. 2021, leg. A.I. Larchanka; ex N. leisleri, from Gomel Reg., Lyelchytsy distr., (51.61896, 28.47302), 22 Jul. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Lyelchytsy distr., (51.92495, 28.12423), 15 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Zhytkavichy distr., (52.03505, 28.15506), 14 Aug. 2021, leg. A.I. Larchanka; ex P. pygmaeus, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex N. leisleri, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex My. daubentonii, from Gomel Reg., Narowlya distr., (51.532544, 29.812548), 26 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.91452, 24.11705), 31 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.84145, 24.03572), 1 Sept. 2021, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.84064, 24.25756), 2 Sept. 2021, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Myadzyel distr., (54.89271, 26.68038), 18 Jul. 2019, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Barysaw distr., (54.65279, 28.23862), 10 Aug. 2020, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Barysaw distr., (54.52527509, 28.44863634), 13 Aug. 2020, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Stowbtsy distr., (53.789523, 26.331697), 25 Jul. 2022, leg. A.I. Larchanka; ex N. leisleri, from Minsk Reg., Stowbtsy distr., (53.852479, 26.427339), 26 Jul. 2022, leg. A.I. Larchanka; ex N. noctula, from Mogilev Reg., Krasnapollye distr., (53.438164, 31.370819), 12 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Mogilev Reg., Krasnapollye distr., (53.438164, 31.370819), 13 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Haradok distr., (55.718735, 29.752421), 2 Aug. 2023, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Dokshytsy distr., (54.96886, 28.01808), 11 Aug. 2021, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Lyepyel distr., (54.74879, 28.31484), 9 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Lyepyel distr., (54.74879, 28.31484), 9 Aug. 2021, leg. A.I. Larchanka; ex N. noctula, from Vitebsk Reg., Lyepyel distr., 15 Jul. 1996, leg. S. V. Kruskop.

Distribution — Europe (Dusbábek 1964; Orlova et al. 2020b): Belarus, Bulgaria, Czechia, Estonia, Germany, Hungary, Italy, Latvia, Lithuania, Moldova, Romania, Slovakia, Ukraine, United Kingdom (Stanyukovich 1997; Radovsky 1967; Baker and Craven 2003; Orlova et al. 2021b); former Czechoslovakia (Dusbábek 1964; Radovsky 1967). Transcontinental: Russia (European part) (Bregetova 1956; Stanyukovich 1990; Radovsky 1967; Orlova et al. 2020b). Caucasus: Dagestan (Orlova et al. 2020b). Asia: Azerbaijan, Kazakhstan (Stanyukovich 1997; Radovsky 1967), Kyrgyzstan (Rybin 1983; Stanyukovich 1997), Mongolia (Stanyukovich 1997), China (Tian and Jin 2012).

Hosts — Nyctalus noctula (Medvedev et al. 2000; Orlova et al. 2021a; Stanyukovich 1997; Vshivkov 1963), N. leisleri, N. lasiopterus (Orlova et al. 2021a; Stanyukovich 1997), Myotis daubentonii, My. myotis, My. blythii, My. mystacinus, My. nattereri, Vespertilio murinus, Eptesicus nilssonii (Stanyukovich 1997), Pipistrellus pipistrellus (Orlova et al. 2021a; Stanyukovich 1997; Vshivkov 1963), P. nathusii (Medvedev et al. 2000; Stanyukovich 1997), E. serotinus, E. bottae ognevi Bobrinskii, 1918 (Beron 2014), Barbastella barbastellus (Dusbábek 1964), Rhinolophus ferrumequinum (Vshivkov 1963), P. pygmaeus (this study).

Pathogen detection — Borrelia spp. (Zabashta et al. 2019).

Remark — Two partial COI barcode sequences generated in this study were deposited in GenBank under accession nos. PP266271.1 (Belarus; closest matches: Dinychidae sp., MG414724.1, 81.05% identity, and Macrocheles sp., MF912910.1, 81.34% identity) and PP266270.1 (Russia, Republic of Mordovia; closest matches: Stratiolaelaps marilyn, AY184365.1, 80.59% identity, and Ologamasidae sp., HQ558584.1, 80.33% identity). The latter was included as a comparative reference to confirm species identification. At the time of analysis, these were the only available barcodes of M. flavus in GenBank.

Macronyssus kolenatii (Oudemans, 1902)

Distribution — Europe: Belarus (Orlova et al. 2021b), Estonia, Latvia, Lithuania, Moldova, Ukraine, Germany, Hungary, Poland, Ireland, United Kingdom (Stanyukovich 1997; Radovsky 1967; Haitlinger and Walter 1997; Baker and Craven 2003). Transcontinental: Russia (Stanyukovich 1997; Orlova et al. 2021a). Caucasus: Armenia (Stanyukovich 1997; Ogadjanian and Arutyunian 1974). Asia: Kazakhstan, Uzbekistan (Stanyukovich 1997). Africa: Egypt (Stanyukovich 1997; Radovsky 1967; Haitlinger and Walter 1997; Orlova et al. 2021a).

Hosts — Pipistrellus pipistrellus, P. nathusii, Myotis dasycneme, My. brandtii, My. mystacinus, Vespertilio murinus, Eptesicus nilssonii (Stanyukovich 1997), P. pygmaeus (Orlova et al. 2021a), P. kuhlii (Radovsky 1967; Stanyukovich 1997), My. daubentonii, My. blythii, P. maderensis (Dobson, 1878) (Beron 2014), My. bechsteinii, Nyctalus noctula (Haitlinger and Walter 1997).

Pathogen detection — Not reported.

Subfamily Ornithonyssinae

Genus Steatonyssus Kolenati, 1858

Steatonyssus noctulus Rybin, 1992

Records from Brest, Gomel, Grodno, and Minsk regions in 1998–2023, obtained mainly from Nyctalus noctula; additional records were made from N. leisleri.

Material — ex N. noctula, from Brest Reg., Brest distr., (51.555143, 23.602705), 15 Jul. 1998, leg. A.I. Larchanka, V. V. Dziamianchyk; ex N. noctula, from Gomel Reg., Chachersk distr., (53.087308, 31.213771), 7 Jun. 2023, leg. A.I. Larchanka; ex N. leisleri, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex N. noctula, from Gomel Reg., Rechytsa distr., (52.437113, 30.407618), 27 Jun. 2023, leg. A.I. Larchanka; ex N. noctula, from Grodno Reg., Svislach distr., (52.84145, 24.03572), 1 Sept. 2021, leg. A.I. Larchanka; ex N. noctula, from Minsk Reg., Myadzyel distr., (54.89271, 26.68038), 18 Jul. 2019, leg. A.I. Larchanka; ex N. leisleri, from Minsk Reg., Stowbtsy distr., (53.852479, 26.427339), 26 Jul. 2022, leg. A.I. Larchanka.

Distribution — Europe: Belarus (as Belorussia), Latvia, Moldova (as Moldava), Ukraine (Stanyukovich 1997), Germany (Rupp and Ludwig 2000), United Kingdom (Baker and Craven 2003). Baltic States are also mentioned as a regional summary by Medvedev et al. (2000). Transcontinental: Russia (Medvedev et al. 2000; Orlova et al. 2021a; Stanyukovich 1997; Zabashta et al. 2019). Asia: Azerbaijan (Stanyukovich 1997), Kazakhstan (Stanyukovich 1997; Medvedev et al. 2000), Kyrgyzstan (Rybin 1992; Stanyukovich 1997; Medvedev et al. 2000).

Hosts — Nyctalus noctula (Medvedev et al. 2000; Stanyukovich 1997; Zabashta et al. 2019), N. lasiopterus, N. leisleri, Eptesicus serotinus (Orlova et al. 2021a), Miniopterus schreibersii (Stanyukovich 1997).

Pathogen detection — Not reported.

Steatonyssus spinosus Willmann, 1936

Records from Gomel and Mogilev regions in 2023, obtained from Eptesicus serotinus and Pipistrellus pygmaeus.

Material — ex E. serotinus, from Gomel Reg., Chachersk distr., (52.962972, 31.201861), 8 Jun. 2023, leg. A.I. Larchanka; ex P. pygmaeus, from Mogilev Reg., Kruhlaye distr., (54.149583, 29.44224), 10 Jul. 2023, leg. A.I. Larchanka.

Distribution — Europe: Belarus (this study), Estonia, Latvia, Moldova, Ukraine, Germany, former Czechoslovakia, France, including Corsica (Stanyukovich 1997; Radovsky 1967). Transcontinental: Russia (Stanyukovich 1997; Radovsky 1967; Medvedev et al. 1991; Orlova et al. 2021a). Caucasus: Armenia (Stanyukovich 1997). Asia: Turkmenistan, Kyrgyzstan (Rybin 1983; Stanyukovich 1997), Korea, China (Stanyukovich 1997).

Hosts — Vespertilio murinus (Orlova et al. 2021a; Stanyukovich 1997), Myotis myotis, My. blythii, My. daubentonii, My. mystacinus, Pipistrellus pipistrellus, Eptesicus serotinus, Nyctalus noctula, N. leisleri, Barbastella barbastellus, Plecotus auritus, Rhinolophus ferrumequinum, R. hipposideros (Stanyukovich 1997), My. dasycneme, My. petax, My. davidii, My. sibiricus, P. pygmaeus, P. nathusii, E. nilssonii, Pl. ognevi (Orlova et al. 2021a), Hypsugo alaschanicus (as Pipistrellus savii), Vespertilio sinensis (as V. superans) (Medvedev et al. 1991), N. aviator (Thomas, 1911) (Beron 2014).

Pathogen detection — Not reported.

Steatonyssus periblepharus Kolenati, 1858

Records from Brest, Gomel, Grodno, Minsk, Mogilev, and Vitebsk regions in 1996–2023, obtained mainly from Pipistrellus nathusii; additional records were made from Myotis daubentonii (Orlova et al. 2021b), P. pygmaeus, and Nyctalus noctula.

Material — ex P. nathusii, from Brest Reg., Brest distr., 9 Jun. 2016, leg. A.I. Larchanka, V. V. Dziamianchyk; ex N. noctula, from Brest Reg., Brest distr., (52.098115, 23.760005), 18 Aug. 2006, leg. A.I. Larchanka, V. V. Dziamianchyk; ex P. pygmaeus, from Brest Reg., Kamyenyets distr., (52.62881, 23.85598), 3 Sept. 2021, leg. A.I. Larchanka; ex P. nathusii, from Brest Reg., Stolin distr., (52.141970, 26.811713), 27 May 2008, leg. A.I. Larchanka, V. V. Dziamianchyk; ex P. pygmaeus, from Gomel Reg., Chachersk distr., (52.962972, 31.201861), 8 Jun. 2023, leg. A.I. Larchanka; ex P. nathusii, from Gomel Reg., Lyelchytsy distr., (51.71111, 28.45722), 21 Jul. 2021, leg. A.I. Larchanka; ex P. pygmaeus, from Gomel Reg., Zhytkavichy distr., (52.03505, 28.15506), 14 Aug. 2021, leg. A.I. Larchanka; ex P. pygmaeus, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex P. nathusii, from Gomel Reg., Narowlya distr., (51.60573, 29.73621), 25 Jul. 2023, leg. A.I. Larchanka; ex P. nathusii, from Gomel Reg., Rechytsa distr., (52.441687, 30.379265), 26 Jun. 2023, leg. A.I. Larchanka; ex P. pygmaeus, from Gomel Reg., Rechytsa distr., (52.437113, 30.407618), 27 Jun. 2023, leg. A.I. Larchanka; ex P. pygmaeus, from Grodno Reg., Svislach distr., (52.84145, 24.03572), 1 Sept. 2021, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Myadzyel distr., (54.89271, 26.68038), 18 Jul. 2019, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Myadzyel distr., (54.87962, 26.85766), 19 Jul. 2019, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Myadzyel distr., (54.96613, 26.37398), 20 Jul. 2019, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Chervyen distr., (53.68863, 28.19855), 6 Jul. 2019, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Barysaw distr., (54.52527509, 28.44863634), 13 Aug. 2020, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Salihorsk distr., (52.658241, 27.522889), 17 Aug. 2023, leg. A.I. Larchanka; ex P. pygmaeus, from Minsk Reg., Stowbtsy distr., (53.789523, 26.331697), 25 Jul. 2022, leg. A.I. Larchanka; ex P. nathusii, from Minsk Reg., Stowbtsy distr., (53.913209, 26.698769), 28 Jul. 2022, leg. A.I. Larchanka; ex P. pygmaeus, from Mogilev Reg., Bykhaw distr., (55.34589, 29.21235), 4 Jul. 2019, leg. A.I. Larchanka; ex P. pygmaeus, from Mogilev Reg., Kruhlaye distr., (54.149583, 29.44224), 10 Jul. 2023, leg. A.I. Larchanka; ex P. pygmaeus, from Mogilev Reg., Slawharad distr., (53.407402, 31.019938), 12 Jul. 2023, leg. A.I. Larchanka; ex P. nathusii, from Mogilev Reg., Slawharad distr., (53.407402, 31.019938), 12 Jul. 2023, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Haradok distr., (55.657437, 29.584828), 27 Aug. 2022, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Haradok distr., (55.772468, 29.8333098), 1 Aug. 2023, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Haradok distr., (55.718735, 29.752421), 2 Aug. 2023, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Dokshytsy distr., (54.96886, 28.01808), 11 Aug. 2021, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Lyepyel distr., (54.74879, 28.31484), 9 Aug. 2021, leg. A.I. Larchanka; ex P. nathusii, from Vitebsk Reg., Lyepyel distr., 15 Jul. 1996, leg. S. V. Kruskop; ex P. nathusii, from Vitebsk Reg., Rasony distr., (55.98842, 28.60384), 4 Aug. 2021, leg. A.I. Larchanka.

Distribution — Europe: Belarus (Orlova et al. 2021b), Estonia, Latvia, Lithuania, Moldova, Ukraine, Bulgaria, Ireland, United Kingdom (Stanyukovich 1997; Radovsky 1967; Medvedev et al. 2000; Baker and Craven 2003). Transcontinental: Russia (Stanyukovich 1997; Medvedev et al. 2000; Orlova et al. 2021a). Caucasus: Armenia, Azerbaijan, Georgia (Stanyukovich 1997; Medvedev et al. 2000). Asia: Lebanon, Israel, Palestine, Jordan, Iraq, Iran (Stanyukovich 1997; Benda et al. 2016), Turkmenistan, Uzbekistan, Kyrgyzstan, Afghanistan (Rybin 1983; Stanyukovich 1997), Pakistan, Mongolia, China (Stanyukovich 1997; Benda et al. 2014). Africa: Algeria, Egypt, Libya (Stanyukovich 1997; Radovsky 1967; Benda et al. 2014; Orlova et al. 2021a).

Hosts — Pipistrellus nathusii (Medvedev et al. 2000; Orlova et al. 2021a; Zabashta et al. 2019), P. pipistrellus (Orlova and Orlov 2018; Zabashta et al. 2019), P. kuhlii (Orlova et al. 2020b; Zabashta et al. 2019), P. pygmaeus (Zabashta et al. 2019), P. coromandra (Gray, 1838), Myotis blythii, My. myotis, My. mystacinus, My. brandtii, My. capaccinii, My. emarginatus, My. nattereri, Plecotus auritus, Pl. austriacus, Eptesicus serotinus, Barbastella barbastellus, Nyctalus noctula, Rhinolophus ferrumequinum, R. euryale, Miniopterus schreibersii (Stanyukovich 1997), Hypsugo savii (Orlova et al. 2021a), Vespertilio murinus, E. nilssonii, My. daubentonii, My. dasycneme (Orlova et al. 2021a; Stanyukovich 1997).

Pathogen detection — Borrelia burgdorferi s. l., genospecies Borrelia afzelii (Zabashta et al. 2019), Bartonella sp. (Sándor et al. 2024), Trypanosoma dionisii (Malysheva et al. 2023).

Discussion

Although knowledge of the acarofauna of bats in Belarus remains incomplete, the currently available data are important for understanding the distribution patterns of bat-associated mites in Eastern Europe. The species assemblage revealed here includes both widespread European forms and taxa associated with particular host groups, which gives the material special value for zoogeographical analysis. At the same time, the present study does not fully reflect the true infestation levels of bats in Belarus, because the sampling design was intended primarily to document species composition, host associations, and distribution rather than to estimate quantitative parasitological parameters. Nevertheless, the resulting host-linked records provide a useful basis for assessing host specificity, especially in widespread and frequently captured bat species represented by larger sample sizes.

The confirmed host-association records nevertheless reveal clear patterns of host affinity (Fig. 1). Among Spinturnicidae, S. myoti was associated mainly with bats of the genus Myotis, especially My. daubentonii and My. dasycneme, whereas records from Pipistrellus and Plecotus were only occasional. S. acuminata was found chiefly on Nyctalus, particularly N. noctula and N. leisleri, with only isolated findings on P. nathusii and Pl. auritus. Similarly, S. punctata was recorded predominantly from B. barbastellus, with only sporadic records from My. nattereri and N. noctula, whereas S. plecotina was found exclusively on Pl. auritus. Other spinturnicids were represented by narrower host sets, with S. kolenatii recorded mainly from Eptesicus bats and S. mystacina from My. brandtii, My. nattereri, and B. barbastellus. Taken together, these patterns agree well with the generally high host specificity reported for European spinturnicid mites.

Macronyssid mites in Belarus likewise formed several recognizable host–parasite complexes. St. noctulus was restricted to Nyctalus, whereas St. periblepharus was associated mainly with Pipistrellus, especially P. nathusii and P. pygmaeus, and only occasionally recorded from other hosts. A similar pattern was observed in M. flavus, which occurred predominantly on Nyctalus, particularly N. noctula, but was also found sporadically on Pipistrellus and My. daubentonii. By contrast, M. corethroproctus was recorded mainly from My. dasycneme, while its isolated findings on P. nathusii and Nyctalus probably reflect transfers in shared roosts. The less frequently recorded species, including M. diversipilis, M. kolenatii, and St. spinosus, were too sparsely represented for stronger inference, but their observed host associations did not contradict published data. The same interpretation may apply to other atypical host records in our material, such as S. myoti on Pipistrellus and Plecotus or S. punctata on N. noctula.

The barcode data obtained in this study further expand current knowledge of bat-associated mites in the region. In particular, partial COI sequences were obtained for Belarusian representatives of S. punctata, S. myoti, M. flavus and M. corethroproctus. At present, however, their interpretative value remains limited because reference sequences in GenBank are still scarce, and for some taxa previously published sequences correspond to different, non-overlapping regions of the COI gene. As a result, direct comparison with available data is often impossible or only partially informative. The new sequences should therefore be regarded primarily as a baseline resource for future integrative studies combining morphology, host association, and molecular markers.

Acknowledgments

The authors are grateful to the staff of the Laboratory of Population Ecology of Terrestrial Vertebrates and Bioresource Management at the State Scientific and Production Association ''Scientific and Practical Center for Bioresources of the National Academy of Sciences of Belarus'' for their assistance in organizing field trips and collecting material, the Department of Entomology, Moscow State University for providing material from an archival collection and V. V. Dziamianchyk for providing material from his personal collection.

References

1. Arzamasov I.T. 1968. Gamazovye kleshchi fauny Belorussii [Gamasid mites of the fauna of Belarus]. Minsk: Nauka i tekhnika. pp. 97. [in Russian]
2. Arzamasov I.T., Kurskov A.N. 1962. K faune ektoparazitov letuchikh myshei v usloviyakh Belorussii [On the fauna of ectoparasites of bats in Belarus]. Dokl. Akad. Nauk BSSR, 6(3): 202-203. [in Russian]
3. Barratt E.M., Deaville R., Burland T.M., Bruford M.W., Jones G., Racey P.A., Wayne R.K. 1997. DNA answers the call of pipistrelle bat species. Nature, 387(6629): 138-139. https://doi.org/10.1038/387138b0
4. Baker A. S., Craven J. C. 2003. Checklist of the mites (Arachnida: Acari) associated with bats (Mammalia: Chiroptera) in the British Isles. Systematic & Applied Acarology Special Publications, 14: 1-20. https://doi.org/10.11158/saasp.14.1.1
5. Benda P., Faizolâhi K., Andreas M., Obuch J., Reiter A., Ševčík M., Uhrin M., Vallo P., Ashrafi S. 2012. Bats (Mammalia: Chiroptera) of the Eastern Mediterranean and Middle East. Part 10. Bat fauna of Iran. Acta Soc. Zool. Bohem., 76(1/4): 163-582.
6. Benda P., Abi Said M.R., Bou Jaoude I., Karanouh R., Lučan R.K., Sadek R., Ševčík M., Uhrin M., Horáček I. 2016. Bats (Mammalia: Chiroptera) of the Eastern Mediterranean and Middle East. Part 13. Review of distribution and ectoparasites of bats in Lebanon. Acta Soc. Zool. Bohem., 80: 207-316.
7. Benda P., Spitzenberger F., Hanák V., Andreas M., Reiter A., Ševčík M., Šmíd J., Uhrin M. 2014. Bats (Mammalia: Chiroptera) of the Eastern Mediterranean and Middle East. Part 11. On the bat fauna of Libya II. Acta Soc. Zool. Bohem., 78: 1-162.
8. Beron P. 2014. Acarorum Catalogus III: Opilioacarida, Holothyrida, Mesostigmata. Sofia: Pensoft & National Museum of Natural History. pp. 286.
9. Beron P. 2020. Acarorum Catalogus VI: Order Mesostigmata. Gamasina: Dermanyssoidea (Rhinonyssidae, Spinturnicidae). Pensoft Publishers. pp. 265. https://doi.org/10.3897/ab.e54206
10. Bregetova N.G. 1956. Gamazovye kleshchi (Gamasoidea): kratkii opredelitel′ [Gamasid mites (Gamasoidea): a brief key]. Moscow; Leningrad: Izd-vo AN SSSR. pp. 243. [in Russian]
11. Chikilevskaya I. V., Labetskaya A.G., Efremova G.A., Balagina N.I. 1998. Kleshchi fauny Belarusi: Katalog [Mites of the fauna of Belarus: Catalogue]. Minsk: BelADI. pp. 224. [in Russian]
12. Dietz C., Kiefer A. 2016. Bats of Britain and Europe. Bloomsbury USA. pp. 400.
13. Dusbábek F. 1964. Parasitische Fledermausmilben der Tschechoslowakei II. Fam. Dermanyssidae Kol. 1859. Čs. Parasitol., 11: 77-125.
14. Dusbábek F., Radovsky F.J. 1972. Macronyssus heteromorphus (Acarina: Macronyssidae) a new species from the Kuril Islands. J. Med. Entomol., 9(6): 575-579. https://doi.org/10.1093/jmedent/9.6.575
15. Gauckler A., Kraus M. 1970. Kennzeichen und Verbreitung von Myotis brandtii (Eversmann, 1845). Z. Säugetierkd., 35: 113-124.
16. Haitlinger R. 1978. Pasozyty zewnetrzne nietoperzy Dolnego Slaska. IV. Macronyssidae, Dermanissidae, Veigaiaidae. Wiad. Parazytol., 24: 707-718.
17. Haitlinger R., Walter G. 1997. Data relating to the distribution and host specificity of bat-infesting mites (Acari, Mesostigmata, Prostigmata, Astigmata) in Germany. Drosera, 97(2): 95-112.
18. Hanák V. 1970. Notes on the distribution and systematics of Myotis mystacinus Kuhl, 1819. Bijdr. Dierkd., 40(1): 57-58. https://doi.org/10.1163/26660644-04001016
19. Jones G., von Parijs S.M. 1993. Bimodal echolocation in pipistrelle bats: are cryptic species present? Proc. R. Soc. Lond. B, 251: 119-125. https://doi.org/10.1098/rspb.1993.0017
20. Larchanka A. 2026. Bat ectoparasites and host associations from Belarus. [Internet]. [16 April 2026]. Minsk: Central Botanical Garden of NAS Belarus; [16 April 2026]. Available from: https://doi.org/10.15468/8v8fxx (via GBIF.org).
21. Lučan R.K., Bandouchova H., Bartonička T., Pikula J., Zahradníková A., Zukal J., Martínková N. 2016. Ectoparasites may serve as vectors for the white-nose syndrome fungus. Parasit. Vectors, 9(1): 16. https://doi.org/10.1186/s13071-016-1302-2
22. Malysheva M.N., Ganyukova A.I., Frolov A.O., Chistyakov D. V., Kostygov A.Yu. 2023. The mite Steatonyssus periblepharus is a novel potential vector of the bat parasite Trypanosoma dionisii. Microorganisms, 11(12): 2906. https://doi.org/10.3390/microorganisms11122906
23. Medvedev S.G., Chistyakov D. V., Stanyukovich M.K., Paskhina M. V. 2000. Bat ectoparasites fauna of Sebezh National Park. Nature of the Pskov Region, 11: 22-25.
24. Medvedev S.G., Stanyukovich M.K., Tiunov M.P., Farafonova G. V. 1991. Ektoparazity letuchikh myshei Dal′nego Vostoka [Ectoparasites of bats of the Far East]. Parazitologiya, 25(1): 27-38. [in Russian]
25. Ogadjanian A.M., Arutyunian E.S. 1974. Mites of the family Macronyssidae Oudemans, 1936 (Parasitiformes, Gamasoidea) parasitising on bats of Armenia. Biol. J. Arm., 27(10): 75-82.
26. Orlova M. V. 2011. Ectoparasite associations of bats from Urals (Russia). Hystrix It. J. Mamm., 22(1): 105-110.
27. Orlova M. V., Anisimov N. V. 2023. Three new species of bat-parasitic gamasid mites of the genera Spinturnix, Macronyssus and Steatonyssus (Acari: Mesostigmata: Spinturnicidae, Macronyssidae) from Siberia and Mongolia, with keys to species of Russia and adjacent countries. Pers. J. Acarol., 12(2): 211-239.
28. Orlova M. V., Chistyakov D. V., Orlov O.L., Kruger F., Kshnyasev I.A. 2014. Ectoparasite fauna of pond bat Myotis dasycneme (Boie, 1825) (Chiroptera, Vespertilionidae) in Northern Eurasia. Bull. St. Petersbg. Univ., 3(1): 24-38.
29. Orlova M. V., Kapitonov V. I., Grigoriev A. K., Orlov O. L. 2011. Bat ectoparasites of Udmurtia Republic. Vestnik Udmurtskogo universiteta, Seria Biologia, Nauki o Zemle, 2: 134-138. [in Russian]
30. Orlova M. V., Kazakov D. V. 2016. New findings of rare species of the mite genus Spinturnix von Heyden, 1826 (Mesostigmata, Gamasina: Spinturnicidae) in Russia and Tajikistan. Entomol. Rev., 96(7): 922-925. https://doi.org/10.1134/S0013873816070150
31. Orlova M. V., Kazakov D. V., Kravchenko L.B., Zhigalin A. V. 2017. Ectoparasite fauna of the Siberian bat Myotis sibiricus (Chiroptera: Vespertilionidae) with a revision of previous data on ectoparasites from Brandt's bat Myotis brandtii s. l. and the whiskered bat M. mystacinus s. l. of the Eastern Palaearctic. Entomol. Rev., 97(8): 1166-1173. https://doi.org/10.1134/S0013873817080164
32. Orlova M. V., Klimov P.B., Orlov O.L., Smirnov D.G., Zhigalin A. V., Budaeva I. V., Emelyanova A.A., Anisimov N. V. 2021a. A checklist of bat-associated macronyssid mites (Acari: Gamasina: Macronyssidae) of Russia, with new host and geographical records. Zootaxa, 4974(3): 537-564. https://doi.org/10.11646/zootaxa.4974.3.4
33. Orlova M. V., Larchanka A.I., Klimov P.B., Orlov O.L., Anisimov N. V. 2021b. A survey of bat ectoparasitic mites of Belarus. Int. J. Acarol., 47(5): 451-455. https://doi.org/10.1080/01647954.2021.1942548
34. Orlova M. V., Laverty T.M., Reeves W.K., Gratton E.M., Davies M.L. 2020a. The first record of the spinturnicid mite Spinturnix kolenatii Oudemans, 1910 (Mesostigmata: Gamasina: Spinturnicidae) from the long-tailed serotine bat Eptesicus hottentotus A. Smith, 1833 (Chiroptera: Vespertilionidae) in Africa. Int. J. Acarol., 46(3): 160-164. https://doi.org/10.1080/01647954.2020.1731596
35. Orlova M. V., Orlov O.L. 2018. Contribution to the Ectoparasite Fauna of Bats (Chiroptera: Vespertilionidae, Rhinolophidae) of Crimea. Entomol. Rev., 98(3): 319-323. https://doi.org/10.1134/S0013873818030089
36. Orlova M. V., Orlov O.L., Zhigalin A. V. 2014. New records of ectoparasites of the eastern water bat Myotis petax Hollister, 1912 (Vespertilionidae, Chiroptera) and the revision of the material previously collected from Myotis daubentonii s. lato in the eastern Palaearctic. Entomol. Rev., 94(9): 1306-1312. https://doi.org/10.1134/S0013873814090115
37. Orlova M. V., Smirnov D.G., Anisimov N. V., Orlov O.L., Klimov P.B., Vekhnik V.P., Murashko E.S., Lukyanenko A.M. 2020b. Parasitic macronyssid mites (Mesostigmata: Macronyssidae) from bats of Northern Caucasus with key for females of the genus Macronyssus Kolenati, 1858 of Russia and adjacent countries. Int. J. Acarol., 46(5): 364-372. https://doi.org/10.1080/01647954.2020.1801839
38. Orlova M. V., Stanyukovich M.K., Orlov O.L. 2015. Gamasid mites (Mesostigmata: Gamasina) associated with bats (Chiroptera: Vespertilionidae, Rhinolophidae, Molossidae) of boreal Palaearctic zone (Russia and adjacent countries). Babenko A. S. (Ed) Tomsk: Publishing House of Tomsk State University. pp. 150.
39. Orlova M. V., Thong V. D., Anisimov N. V., Smirnov D. G., Orlov O. L. 2021c. New findings of spinturnicid mites (Mesostigmata: Gamasina: Spinturnicidae) from the Caucasus. Parasitol. Int., 85: 102429. https://doi.org/10.1016/j.parint.2021.102429
40. Orlova M. V., Zapart A. 2012. Interaction of ectoparasites in cohabitating colonies of pond bats Myotis dasycneme (Boie, 1825) and species of genus Pipistrellus from northern Poland. Ann. Parasitol., 58(4): 211-215.
41. Orlova M. V., Zhigalin A. V., Orlov O.L., Kruskop S. V., Bogdanov I.I. 2015. Contribution to the ectoparasite fauna of rare and poor studied bat species of Southern Siberia. Biol. Bull. Russ. Acad. Sci., 42(3): 254-259. https://doi.org/10.1134/S1062359015030085
42. Radovsky F. 2010. Revision of Genera of the Parasitic Mite Family Macronyssidae (Mesostigmata: Dermanyssoidea) of the World. Michigan: Indira Publishing House. pp. 170.
43. Radovsky F.J. 1967. The Macronyssidae and Laelapidae (Acarina: Mesostigmata) parasitic on bats. Univ. Calif. Publ. Entomol., 46: I-VIII + 1-288.
44. Rudnick A. 1960. A revision of the mites of the family Spinturnicidae (Acarina). Berkeley; Los Angeles: University of California Press. pp. 250.
45. Rupp D., Ludwig P. 2000. First records of Steatonyssus noctulus Rybin, 1992 in Central Europe. Spixiana, 23: 275-278.
46. Rybin S.N. 1983. Gamasid mites of bats and their shelters in South Kyrgyzstan. Parasitologiya, 17(5): 355-360.
47. Rybin S.N. 1992. New species of mites of the genus Steatonyssus (Mesostigmata: Macronyssidae). Parasitologiya, 26(2): 157-161.
48. Sándor A.D., Corduneanu A., Orlova M., Hornok S., Cabezas‐Cruz A., Foucault‐Simonin A., Kulisz J., Zając Z., Borzan M. 2024. Diversity of bartonellae in mites (Acari: Mesostigmata: Macronyssidae and Spinturnicidae) of boreal forest bats: Association of host specificity of mites and habitat selection of hosts with vector potential. Med. Vet. Entomol., 38(4): 518-529. https://doi.org/10.1111/mve.12757
49. Scheffler I., Jargalsaikhan A., Bolorchimeg I., Stubbe A., Stubbe M. 2016. Bat Ectoparasites of Mongolia, Part 3. Erforsch. Biol. Ressour. Mongolei (Halle/Saale), 13: 395-408.
50. Shakun V.V., Solovei I.A., Krishchuk I.A., Mashkov E.I., Veligurov P.A., Larchanka A.I., Novikov D. V., Bychkov V.P. 2026. Atlas mlekopitayushchikh Belarusi [Atlas of mammals of Belarus]. Belaruskaya Navuka. Minsk: National Academy of Sciences of Belarus, Scientific and Practical Center for Bioresources. pp. 165. [in Russian]
51. Stanyukovich M.K. 1990. Gamasid and Argasidae mites of bats of Baltic states and Leningradskaya oblast. Parazitologiya, 24(3): 193-200.
52. Stanyukovich M.K. 1997. Keys to the gamasid mites (Acari: Parasitiformes, Mesostigmata, Macronyssoidea et Laelaptoidea) parasiting bats (Mammalia, Chiroptera) from Russia and adjacent countries. Rudolstadter Nat. Hist., 7: 13-46.
53. Szubert-Kruszyńska A., Stańczak J., Cieniuch S., Podsiadły E., Postawa T., Michalik J. 2019. Bartonella and Rickettsia Infections in Haematophagous Spinturnix myoti Mites (Acari: Mesostigmata) and their Bat Host, Myotis myotis (Yangochiroptera: Vespertilionidae), from Poland. Microb. Ecol., 77(3): 759-768. https://doi.org/10.1007/s00248-018-1246-5
54. Tian Z.-Z., Jin D.-C. 2012. Study on the genus Macronyssus (Acari: Macronyssidae) with description of a new species, redescription of a known species from the genus Myotis (Chiroptera: Vespertilionidae) and a key to the species in China. Int. J. Acarol., 38(3): 179-190. https://doi.org/10.1080/01647954.2011.633559
55. Thiévent K., Szentiványi T., Aeby S., Glaizot O., Christe P., Greub G. 2020. Presence and diversity of Chlamydiae bacteria in Spinturnix myoti, an ectoparasite of bats. Parasite, 27: 54. https://doi.org/10.1051/parasite/2020052
56. Uchikawa K., Wada Y. 1979. Studies on mesostigmatid mites parasitic on mammals and birds in Japan\,: IX. Bat mites of the genus Spinturnix von Heyden, 1829 (Part I) (Spinturnicidae). Med. Entomol. Zool., 30(2): 121-125. https://doi.org/10.7601/mez.30.121
57. Voropaev E. V., Padutov V.E., Baranov O.Yu. 2007. Metody molekulyarno-geneticheskogo analiza [Methods of molecular genetic analysis]. Minsk: Yunipol. pp. 176. [in Russian]
58. Vshivkov F.N. 1963. Gamazic mites of bats of Crimea. In: Pogrebn L. P. (Ed) Materials of the IV Conference of parasitologists of the Ukrainian SSR «Problems of Parasitology», Kiev: Academy of Sciences of the Ukrainian SSR. pp. 324-326.
59. Zabashta M. V., Orlova M. V., Pichurina N.L., Khametova А.P., Romanova L. V., Borodina T.N., Zabashta A. V. 2019. Participation of bats (Chiroptera, Mammalia) and their ectoparasites in the circulation of pathogens of natural focal infections in the south of Russia. Parasitologia, 53(1): 3-13.
60. Zheng X., Zhang X., Deng Y., Li Y., Gu Y., Huang X. 2025. Molecular detection of Bartonella in bats and their ectoparasites, Spinturnix myoti, from central and Western Yunnan Province, China. Vet. Res. Commun., 49(3): 132. https://doi.org/10.1007/s11259-025-10704-0

instructions